Effect of Dietary Porphyran from the Red Alga, Porphyra yezoensis, on Glucose Metabolism in Diabetic KK-Ay Mice
نویسندگان
چکیده
منابع مشابه
Effect of dietary porphyran from the red alga, Porphyra yezoensis, on glucose metabolism in diabetic KK-Ay mice.
Porphyran (POR) from the red alga Porphyra yezoensis is a water soluble dietary fiber. In this study, we investigated the effect of dietary POR on glucose metabolism in KK-Ay mice (a model for type 2 diabetes). Mice were divided into 4 groups and fed a diet containing 5% cellulose (control), POR, POR Arg or POR K. After 3 wk of feeding, plasma insulin levels and the calculated homeostasis model...
متن کاملIsolation of porphyran-degrading marine microorganisms from the surface of red alga, Porphyra yezoensis.
Marine microorganisms degrading porphyran (POR) were found on the surface of thalli of Porphyra yezoensis. Fifteen crude microorganism groups softened and liquefied the surface of agar-rich plate medium. Among these, 11 microorganism groups degraded porphyran that consisted of sulfated polysaccharide in Porphyra yezoensis. Following isolation, 7 POR-degradable microorganisms were isolated from ...
متن کاملEffects of cell wall synthesis on cell polarity in the red alga Porphyra yezoensis.
Polarity is a fundamental cell property essential for differentiation, proliferation and morphogenesis in unicellular and multicellular organisms. We have recently demonstrated that phosphatidylinositol 3-kinase (PI3K) activity is required for the establishment of anterior-posterior axis, leading to asymmetrical localization of F-actin in migrating monospores of the red alga Porphyra yezoensis....
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملEffect of corosolic acid on dietary hypercholesterolemia and hepatic steatosis in KK-Ay diabetic mice.
Corosolic acid (CA), contained in the leaves of the banaba plant (Lagerstroemia speciosa L.), is a pentacyclic triterpene, and has hypoglycemic effects. The effects of CA on dietary hypercholesterolemia and hepatic steatosis were assessed in KK-Ay mice, an animal model of type 2 diabetes. Two kinds of high cholesterol diet with or without 0.023% CA, were prepared for the study. KK-Ay mice were ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Journal of Nutritional Science and Vitaminology
سال: 2012
ISSN: 0301-4800,1881-7742
DOI: 10.3177/jnsv.58.14